AntibodiesNeuroMab
Anti-VGLUT1 Antibody-Oligo Conjugate
SKU: aoc9
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VGLUT1 Antibody-IF1
Antibody Target
- Target
- VGLUT1
- UniProt Number
- Q9P2U7
- Target Description
- Multifunctional transporter that transports L-glutamate as well as multiple ions such as chloride, proton, potassium, sodium and phosphate (PubMed:10820226). At the synaptic vesicle membrane, mainly functions as an uniporter which transports preferentially L-glutamate but also phosphate from the cytoplasm into synaptic vesicles at presynaptic nerve terminals of excitatory neural cells (By similarity). The L-glutamate or phosphate uniporter activity is electrogenic and is driven by the proton electrochemical gradient, mainly by the electrical gradient established by the vacuolar H(+)-ATPase across the synaptic vesicle membrane (By similarity). In addition, functions as a chloride channel that allows a chloride permeation through the synaptic vesicle membrane that affects the proton electrochemical gradient and promotes synaptic vesicles acidification (By similarity). Moreover, may function as a K(+)/H(+) antiport allowing to maintain the electrical gradient and to decrease chemical gradient and therefore sustain vesicular glutamate uptake (By similarity). The vesicular K(+)/H(+) antiport activity is electroneutral (By similarity). At the plasma membrane, following exocytosis, functions as a symporter of Na(+) and phosphate from the extracellular space to the cytoplasm allowing synaptic phosphate homeostasis regulation (PubMed:10820226). The symporter activity is driven by an inside negative membrane potential and is electrogenic (By similarity). Is necessary for synaptic signaling of visual-evoked responses from photoreceptors (By similarity)..
- Molecular Weight
- 52 kDa
- Synonyms
- Vesicular glutamate transporter 1 (VGluT1) (Brain-specific Na(+)-dependent inorganic phosphate cotransporter) (Solute carrier family 17 member 7)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCFlow Cytometry
- Specificity
- Does not cross-react with VGlut2 or VGlut3
- Clone
- N28/9
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 493-560 (cytoplasmic C-terminus) of rat VGlut1 (accession number Q62634) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- FishHumanMouseRat