AntibodiesNeuroMab
Anti-SCN9A Antibody-Oligo Conjugate
SKU: aoc11
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCN9A Antibody-IF1
Antibody Target
- Target
- SCN9A
- UniProt Number
- Q15858
- Target Description
- Pore-forming subunit of Nav1.7, a voltage-gated sodium (Nav) channel that directly mediates the depolarizing phase of action potentials in excitable membranes. Navs, also called VGSCs (voltage-gated sodium channels) or VDSCs (voltage-dependent sodium channels), operate by switching between closed and open conformations depending on the voltage difference across the membrane. In the open conformation they allow Na(+) ions to selectively pass through the pore, along their electrochemical gradient. The influx of Na(+) ions provokes membrane depolarization, initiating the propagation of electrical signals throughout cells and tissues (PubMed:15385606, PubMed:16988069, PubMed:17145499, PubMed:17167479, PubMed:19369487, PubMed:24311784, PubMed:25240195, PubMed:26680203, PubMed:7720699). Nav1.7 plays a crucial role in controlling the excitability and action potential propagation from nociceptor neurons, thereby contributing to the sensory perception of pain (PubMed:17145499, PubMed:17167479, PubMed:19369487, PubMed:24311784)..
- Molecular Weight
- 230 kDa
- Synonyms
- Sodium channel protein type 9 subunit alpha (Neuroendocrine sodium channel) (hNE-Na) (Peripheral sodium channel 1) (PN1) (Sodium channel protein type IX subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.7)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity against other Nav channels
- Clone
- N68/6
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1751-1946 (cytoplasmic C-terminus) of human Nav1.7 (accession number Q15858) produced recombinantly in E. Coli
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat