AntibodiesNeuroMab
Anti-SCN8A Antibody-Oligo Conjugate
SKU: aoc18
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCN8A Antibody-IF1
Antibody Target
- Target
- SCN8A
- UniProt Number
- Q9UQD0
- Target Description
- Pore-forming subunit of a voltage-gated sodium channel complex assuming opened or closed conformations in response to the voltage difference across membranes and through which sodium ions selectively pass along their electrochemical gradient (PubMed:24874546, PubMed:25239001, PubMed:25725044, PubMed:26900580, PubMed:29726066, PubMed:33245860, PubMed:36696443, PubMed:36823201). Contributes to neuronal excitability by regulating action potential threshold and propagation (PubMed:24874546, PubMed:25239001, PubMed:25725044, PubMed:26900580, PubMed:29726066, PubMed:33245860, PubMed:36696443, PubMed:36823201)..; FUNCTION: [Isoform 5]: More specifically expressed in non-neuronal cells, could play a role in sodium release from intracellular compartments and participate in the control of podosomes formation and macrophages adhesion and movement..
- Molecular Weight
- <200 kDa
- Synonyms
- Sodium channel protein type 8 subunit alpha (Peripheral nerve protein type 4) (PN4) (Sodium channel 6) (NaCh6) (Sodium channel protein type VIII subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.6)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- K87A/10
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide 459-476 (intracellular interdomain loop I-II) of rat Nav1.6 (accession number O88420)
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat