AntibodiesNeuroMab
Anti-SCN1A Antibody-Oligo Conjugate
SKU: aoc17
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCN1A Antibody-IF1
Antibody Target
- Target
- SCN1A
- UniProt Number
- P35498
- Target Description
- Pore-forming subunit of Nav1.1, a voltage-gated sodium (Nav) channel that directly mediates the depolarizing phase of action potentials in excitable membranes. Navs, also called VGSCs (voltage-gated sodium channels) or VDSCs (voltage-dependent sodium channels), operate by switching between closed and open conformations depending on the voltage difference across the membrane. In the open conformation they allow Na(+) ions to selectively pass through the pore, along their electrochemical gradient. The influx of Na(+) ions provokes membrane depolarization, initiating the propagation of electrical signals throughout cells and tissues (PubMed:14672992). By regulating the excitability of neurons, ensures that they respond appropriately to synaptic inputs, maintaining the balance between excitation and inhibition in brain neural circuits (By similarity). Nav1.1 plays a role in controlling the excitability and action potential propagation from somatosensory neurons, thereby contributing to the sensory perception of mechanically-induced pain (By similarity)..
- Molecular Weight
- 220 kDa
- Synonyms
- Sodium channel protein type 1 subunit alpha (Sodium channel protein brain I subunit alpha) (Sodium channel protein type I subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Specificity
- No cross-reactivity with Nav1.2Nav1.3 and Nav1.6
- Clone
- K74/71
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1929-2009 (cytoplasmic C-terminus) of rat Nav1.1 (accession number P04774) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMonkey (Non-Human Primate)MouseRat