AntibodiesNeuroMab
Anti-NMDAR1 Antibody-Oligo Conjugate
SKU: aoc26
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NMDAR1 Antibody-IF1
Antibody Target
- Target
- NMDAR1
- UniProt Number
- Q05586
- Target Description
- Component of N-methyl-D-aspartate (NMDA) receptors (NMDARs) that function as heterotetrameric, ligand-gated cation channels with high calcium permeability and voltage-dependent block by Mg(2+) (PubMed:21376300, PubMed:26875626, PubMed:26919761, PubMed:28126851, PubMed:28228639, PubMed:36959261, PubMed:7679115, PubMed:7681588, PubMed:7685113). NMDARs participate in synaptic plasticity for learning and memory formation by contributing to the long-term potentiation (LTP) (PubMed:26875626). Channel activation requires binding of the neurotransmitter L-glutamate to the GluN2 subunit, glycine or D-serine binding to the GluN1 subunit, plus membrane depolarization to eliminate channel inhibition by Mg(2+) (PubMed:21376300, PubMed:26875626, PubMed:26919761, PubMed:27164704, PubMed:28095420, PubMed:28105280, PubMed:28126851, PubMed:28228639, PubMed:36959261, PubMed:38538865, PubMed:7679115, PubMed:7681588, PubMed:7685113). NMDARs mediate simultaneously the potasium efflux and the influx of calcium and sodium (By similarity). Each GluN2 or GluN3 subunit confers differential attributes to channel properties, including activation, deactivation and desensitization kinetics, pH sensitivity, Ca2(+) permeability, and binding to allosteric modulators (PubMed:26875626, PubMed:26919761, PubMed:36309015, PubMed:38598639)..
- Molecular Weight
- 105 kDa
- Synonyms
- Glutamate receptor ionotropic, NMDA 1 (GluN1) (Glutamate [NMDA] receptor subunit zeta-1) (N-methyl-D-aspartate receptor subunit NR1) (NMD-R1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity reported
- Clone
- N308/48
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 42-361 (extracellular N-terminus) of rat NR1 (accession number P35439) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat