AntibodiesNeuroMab

Anti-Kv1.1 Potassium Channel Antibody-Oligo Conjugate

SKU: aoc20

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-Kv1.1 Potassium Channel Antibody-IF1

Antibody Target

Target
Kv1.1 Potassium Channel
UniProt Number
Q09470
Target Description
Voltage-gated potassium channel that mediates transmembrane potassium transport in excitable membranes, primarily in the brain and the central nervous system, but also in the kidney (PubMed:19903818, PubMed:8845167). Contributes to the regulation of the membrane potential and nerve signaling, and prevents neuronal hyperexcitability (PubMed:17156368). Forms tetrameric potassium-selective channels through which potassium ions pass in accordance with their electrochemical gradient. The channel alternates between opened and closed conformations in response to the voltage difference across the membrane (PubMed:19912772). Can form functional homotetrameric channels and heterotetrameric channels that contain variable proportions of KCNA1, KCNA2, KCNA4, KCNA5, KCNA6, KCNA7, and possibly other family members as well; channel properties depend on the type of alpha subunits that are part of the channel (PubMed:12077175, PubMed:17156368). Channel properties are modulated by cytoplasmic beta subunits that regulate the subcellular location of the alpha subunits and promote rapid inactivation of delayed rectifier potassium channels (PubMed:12077175, PubMed:17156368). In vivo, membranes probably contain a mixture of heteromeric potassium channel complexes, making it difficult to assign currents observed in intact tissues to any particular potassium channel family member. Homotetrameric KCNA1 forms a delayed-rectifier potassium channel that opens in response to membrane depolarization, followed by slow spontaneous channel closure (PubMed:19307729, PubMed:19903818, PubMed:19912772, PubMed:19968958). In contrast, a heterotetrameric channel formed by KCNA1 and KCNA4 shows rapid inactivation (PubMed:17156368). Regulates neuronal excitability in hippocampus, especially in mossy fibers and medial perforant path axons, preventing neuronal hyperexcitability. Response to toxins that are selective for KCNA1, respectively for KCNA2, suggests that heteromeric potassium channels composed of both KCNA1 and KCNA2 play a role in pacemaking and regulate the output of deep cerebellar nuclear neurons (By similarity). May function as down-stream effector for G protein-coupled receptors and inhibit GABAergic inputs to basolateral amygdala neurons (By similarity). May contribute to the regulation of neurotransmitter release, such as gamma-aminobutyric acid (GABA) release (By similarity). Plays a role in regulating the generation of action potentials and preventing hyperexcitability in myelinated axons of the vagus nerve, and thereby contributes to the regulation of heart contraction (By similarity). Required for normal neuromuscular responses (PubMed:11026449, PubMed:17136396). Regulates the frequency of neuronal action potential firing in response to mechanical stimuli, and plays a role in the perception of pain caused by mechanical stimuli, but does not play a role in the perception of pain due to heat stimuli (By similarity). Required for normal responses to auditory stimuli and precise location of sound sources, but not for sound perception (By similarity). The use of toxins that block specific channels suggest that it contributes to the regulation of the axonal release of the neurotransmitter dopamine (By similarity). Required for normal postnatal brain development and normal proliferation of neuronal precursor cells in the brain (By similarity). Plays a role in the reabsorption of Mg(2+) in the distal convoluted tubules in the kidney and in magnesium ion homeostasis, probably via its effect on the membrane potential (PubMed:19307729, PubMed:23903368)..
Molecular Weight
85 kDa (major: mature glycosylation)65 kDa (minor: immature glycosylation)
Synonyms
Potassium voltage-gated channel subfamily A member 1 (RBKI) (RCK1) (Voltage-gated potassium channel subunit Kv1.1)

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCIP
Specificity
No cross-reactivity reported
Clone
K20/78
Isotype
IgG1
Form
Liquid
Immunogen
Synthetic peptide amino acids 458-476 (cytoplasmic C-terminus) of rat Kv1.1 (EEDMNNSIAHYRQANIRTG; accession number P10499)
Immunogen Species
Rat
Host Species
Mouse
Species Reactivity
FinchHumanMouseRabbitRat