AntibodiesNeuroMab
Anti-KCNT1 Antibody-Oligo Conjugate
SKU: aoc22
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KCNT1 Antibody-IF1
Antibody Target
- Target
- KCNT1
- UniProt Number
- Q5JUK3
- Target Description
- Sodium-activated K(+) channel (PubMed:37494189). Acts as an important mediator of neuronal membrane excitability (PubMed:37494189). Contributes to the delayed outward currents (By similarity). Regulates neuronal bursting in sensory neurons (By similarity). Contributes to synaptic development and plasticity (By similarity)..
- Molecular Weight
- 140 kDa
- Synonyms
- Potassium channel subfamily T member 1 (Sequence like a calcium-activated potassium channel subunit)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity reported
- Clone
- N3/26
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1168-1237 of rat Slo2.2 (accession number NP_068625) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat