AntibodiesNeuroMab
Anti-KCNC1 Antibody-Oligo Conjugate
SKU: aoc21
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KCNC1 Antibody-IF1
Antibody Target
- Target
- KCNC1
- UniProt Number
- P48547
- Target Description
- Voltage-gated potassium channel that opens in response to the voltage difference across the membrane and through which potassium ions pass in accordance with their electrochemical gradient (PubMed:25401298, PubMed:35840580). The mechanism is time-dependent and inactivation is slow (By similarity). Plays an important role in the rapid repolarization of fast-firing brain neurons (By similarity). Can form functional homotetrameric channels and heterotetrameric channels that contain variable proportions of KCNC2, and possibly other family members as well (By similarity). Contributes to fire sustained trains of very brief action potentials at high frequency in pallidal neurons (By similarity)..
- Molecular Weight
- 110 kDa
- Synonyms
- Potassium voltage-gated channel subfamily C member 1 (NGK2) (RAW2) (Voltage-gated potassium channel subunit Kv3.1) (Voltage-gated potassium channel subunit Kv4)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- N16B/8
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 437-585 (cytoplasmic C-terminus) of rat Kv3.1b (accession number P25122) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HamsterHumanMonkey (Non-Human Primate)MouseRat