AntibodiesNeuroMab
Anti-KCNA3 Antibody-Oligo Conjugate
SKU: aoc15
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KCNA3 Antibody-IF1
Antibody Target
- Target
- KCNA3
- UniProt Number
- P22001
- Molecular Weight
- 70 kDa
- Synonyms
- Potassium voltage-gated channel subfamily A member 3 (RCK3) (RGK5) (Voltage-gated potassium channel subunit Kv1.3) (Voltage-gated potassium channel subunit Kv3)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- L23/27
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide amino acids 485-506 (GGMNHSAFPQTPFKTGNSTATC, cytoplasmic C-terminus) of rat Kv1.3 (accession number P15384)
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat