AntibodiesNeuroMab
Anti-Glutamate Receptor 1 (AMPA Subtype) Antibody-Oligo Conjugate
SKU: aoc24
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Glutamate Receptor 1 (AMPA Subtype) Antibody-IF1
Antibody Target
- Target
- Glutamate Receptor 1 (AMPA Subtype)
- UniProt Number
- P42261
- Target Description
- Ionotropic glutamate receptor that functions as a ligand-gated cation channel, gated by L-glutamate and glutamatergic agonists such as alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), quisqualic acid, and kainic acid (PubMed:1311100, PubMed:20805473, PubMed:21172611, PubMed:28628100, PubMed:35675825). L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse upon entry of monovalent and divalent cations such as sodium and calcium. The receptor then desensitizes rapidly and enters in a transient inactive state, characterized by the presence of bound agonist (By similarity). In the presence of CACNG2 or CACNG4 or CACNG7 or CACNG8, shows resensitization which is characterized by a delayed accumulation of current flux upon continued application of L-glutamate (PubMed:21172611). Resensitization is blocked by CNIH2 through interaction with CACNG8 in the CACNG8-containing AMPA receptors complex (PubMed:21172611). Calcium (Ca(2+)) permeability depends on subunits composition and, heteromeric channels containing edited GRIA2 subunit are calcium-impermeable. Also permeable to other divalents cations such as strontium(2+) and magnesium(2+) and monovalent cations such as potassium(1+) and lithium(1+) (By similarity)..
- Molecular Weight
- 100 kDa
- Synonyms
- Glutamate receptor 1 (GluR-1) (AMPA-selective glutamate receptor 1) (GluR-A) (GluR-K1) (Glutamate receptor ionotropic, AMPA 1) (GluA1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- Does not cross-react with GluR2
- Clone
- N355/1
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1-389 (extracellular N-terminus) of rat GluA1/GluR1 (accession number P19490) produced recombinantly in E. Coli.
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat