AntibodiesNeuroMab
Anti-GABA-B-R1 Antibody-Oligo Conjugate
SKU: aoc10
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GABA-B-R1 Antibody-IF1
Antibody Target
- Target
- GABA B Receptor 1
- UniProt Number
- Q9UBS5
- Target Description
- Component of a heterodimeric G-protein coupled receptor for GABA, formed by GABBR1 and GABBR2 (PubMed:15617512, PubMed:18165688, PubMed:22660477, PubMed:24305054, PubMed:36103875, PubMed:9872316, PubMed:9872744). Within the heterodimeric GABA receptor, only GABBR1 seems to bind agonists, while GABBR2 mediates coupling to G proteins (PubMed:18165688). Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase (PubMed:10075644, PubMed:10773016, PubMed:10906333, PubMed:24305054, PubMed:9872744). Signaling inhibits adenylate cyclase, stimulates phospholipase A2, activates potassium channels, inactivates voltage-dependent calcium-channels and modulates inositol phospholipid hydrolysis (PubMed:10075644). Calcium is required for high affinity binding to GABA (By similarity). Plays a critical role in the fine-tuning of inhibitory synaptic transmission (PubMed:9844003). Pre-synaptic GABA receptor inhibits neurotransmitter release by down-regulating high-voltage activated calcium channels, whereas postsynaptic GABA receptor decreases neuronal excitability by activating a prominent inwardly rectifying potassium (Kir) conductance that underlies the late inhibitory postsynaptic potentials (PubMed:10075644, PubMed:22660477, PubMed:9844003, PubMed:9872316, PubMed:9872744). Not only implicated in synaptic inhibition but also in hippocampal long-term potentiation, slow wave sleep, muscle relaxation and antinociception (Probable). Activated by (-)-baclofen, cgp27492 and blocked by phaclofen (PubMed:24305054, PubMed:9844003, PubMed:9872316)..; FUNCTION: Isoform 1E may regulate the formation of functional GABBR1/GABBR2 heterodimers by competing for GABBR2 binding. This could explain the observation that certain small molecule ligands exhibit differential affinity for central versus peripheral sites.
- Molecular Weight
- 115 kDa
- Synonyms
- Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity against GABABR1
- Clone
- N93A/49
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 873-977 (cytoplasmic C-terminus) of rat GABABR1 (accession number Q9Z0U4) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- ChickenHumanMouseRabbitRat